Introduction

With the advancement in plant molecular biology, synthetic biological approaches are being used routinely to improve crop productivity. Since last 50 years, N fertilizers are being used quite extensively to enhance or to sustain crop yield (McAllister et al. 2012). Although N is an essential element but usually it becomes limiting nutrient for plant growth and development due to leaching of nitrate and volatilization process (Kraiser et al. 2011; Garnett et al. 2015). Only 30–50% of applied N is taken up by plants while the remaining is lost through ammonia volatilization, surface runoff, consumed by soil microbes and by nitrate leaching (Yang et al. 2015; Zhu et al. 2016).

The excessive use of N fertilizer cause imbalance of other essential nutrients necessary for optimum plant growth, contribute toward greenhouse gas emission, nitrate accumulation in underground water used for drinking and cause serious threats to human health (Ahmed et al. 2017). This situation urges the strong demand for the development of nitrogen use efficient crops. Strategies to improve nitrogen use efficiency (NUE) in plants focused mainly upon genetic manipulation for enhancement of N uptake (Araus et al. 2016; Chen et al. 2017), nitrate translocation, N metabolism (Pena et al. 2017) and its regulation. Although, these approaches are generally successful but NUE additionally depends upon N partitioning within plant and efficiency of nitrate or associated amino acid transporters (Mu et al. 2015).

During vegetative growth, plants utilize N in three steps: uptake, translocation, and assimilation. Nitrate and ammonium are the major forms of inorganic N present in agricultural soil (Krapp et al. 2014). Nitrate is the main form of N consumed by many plant species. When nitrate enters the plant cell, it is reduced to nitrite by Nitrate Reductase (NR). Nitrite is transported further to plastids where it undergoes reduction process and converted to ammonia by nitrite reductase. Ammonia then enters the GOGAT (glutamine-oxoglutarate aminotransferase) cycle and transformed to glutamine and glutamate (Santiago and Tegeder 2016). The amino group of glutamate could then be transferred to various amino acids by different aminotransferases (Tegeder 2014). Alanine aminotransferase catalyzes the reversible conversion of alanine and 2-oxoglutarate to pyruvate and glutamate. Alanine is an important amino acid for various reasons (Good et al. 2007; Shrawat et al. 2008) e.g., it is usually excreted by N fixing bacteria and then assimilated into plant roots (Zhang et al. 2015), suggesting its role in organic N metabolism. Additionally, under certain stresses, alanine has been found to be among the major storage amino acids (Good et al. 2007). In most of the cases, 50–75% of applied N to arable lands is utilized by microorganisms or lost through leaching (Yang et al. 2015; Zhu et al. 2016). So the improvement in plant nitrogen use efficiency through genetic engineering has been the focus of research since last decade. Over-expression of barley alanine aminotransferase (AlaAT) gene in canola and rice has been demonstrated with improved nitrogen use efficiency as indicated by measured biomass and grain yield under low nitrogen supply (0.5–4.0 mM) in growth chambers, hydroponics and field trials (Good et al. 2004; Shrawat et al. 2008). A nitrogen efficient phenotype was observed in transgenic rice transformed with barley (HvAlaAT) gene and assessed physiologically under low, medium and high N supply (Beatty et al. 2013). Similarly, transgenic sugarcane, wheat and sorghum expressing HvAlaAT gene were developed and assessed under low nitrogen supply, hydroponics and greenhouse experiments respectively, indicated improvement in nitrogen use efficiency (Snyman et al. 2015; Pena et al. 2017). However, codon optimization of barley alanine aminotransferase (AlaAT) gene by replacing less frequently predicted codons with most favored codons to achieve optimal transcriptional efficiency and translational ability in tobacco (Nicotiana tabacum L.) plants (dicot) is used for the first time to be expressed under 2XCaMV35S promoter. It was hypothesized that introduction of synthetic AlaAT gene could be an effective approach to attain optimal expression level in the targeted plant species.

Materials and Methods

Cloning in binary vector and transformation of tobacco

Barley alanine aminotransferase gene (Accession no. Z26322) was codon optimized by replacing codon predicted to be less frequently use in tobacco with more favored codons according to Codon Usage Database (http://www.kazusa.or.jp). Codon optimization was performed by keeping in view a range of factors involved in protein expression, codon adaptability, mRNA structure, various cis-elements in transcription and translation to have optimum transcriptional competence, translational efficiency and protein folding in tobacco (Nicotian atabacum L.) plants. The codon optimized (co-AlaAT) gene along with the introduction of HindIII and EcoRI restriction sites was got synthesized commercially from M/S Eurofins Genomics, USA anddelivered in general plasmid vector (pBluescript). The pBluescript plasmid was restricted with HindIII and EcoRI restriction enzymes to ligate the codon optimized alanine aminotransferase (co-AlaAT) gene (1453 bp) into pJIT60 vector under 2XCaMV35S promoter and CaMV terminator. Then pJIT60 vector having the whole cassette (2XCaMV35S- co-AlaAT- CaMV) was digested with KpnI and XhoI hexa cutter enzymes and sub-cloned the complete cassette in a pGreen0029 binary vector by using the same restriction sites. This construct was transformed into Agrobacterium tumefaciens strain ‘LBA4404’ through electroporation method. Freshly cut tobacco leaf discs were inoculated with Agrobacterium culture and incubated on MS0 medium (Murashig and Skoog 1962). After shoot and root development, the regenerated plants were transplanted to the soil in pots and three PCR positive putative transgenic lines were selected to raise T₁, T₂, and T₃ generations.

Evaluation of putative transgenic tobacco lines at different N fertilizer regimes

The PCR positive lines were selected to be tested further during 2017–2018 on the basis of their performance at different nitrogen regimes. The selected lines i.e., SAC1, SAC2, and SAC5 were grown in four replicates in pot experiments. Sandy loom soil was weighed to 30 kg/pot of 12’ internal diameter x 14’ height and two tobacco seedlings were transplanted in each pot. Upon suitable settlement of young seedling, one plant/pot was retained for further experimentation. Different N regimes were created by applying urea as N fertilizer at the rate of 0, 75, 100 and 125 kg N/ha and represented as N0, N75, N100 and N125 respectively. Urea fertilizer was applied in three split applications at transplantation, vegetative growth phase and flowering stage. The other fertilizers i.e., phosphorous and potassium were applied ten days after sowing at a rate of 75 kg/ha P₂O₅ and 50 kg/ha K₂O.

Molecular analysis of putative transgenic tobacco lines

DNA was extracted from leaf tissues of putative transgenic tobacco plants by CTAB method (Doyle and Doyle 1987) and tested for codon optimized alanine aminotransferase (co-AlaAT) gene insertion in tobacco genome by PCR. Gene-specific primers (Table 1) were used to amplify co-AlaAT gene with the forward (AlaAT AF) and reverse (AlaAT BR) primers in a PCR reaction of 50 µL volume containing 100 ng plant DNA, 200 µM MgCl2, 200 nM of each primer and 25 µL Dream Taq Green Mix (Fermentas, U.S.A.). The profile used for PCR reaction consisted of [Initial denaturation temperature 94°C for 4 min; 35 cycles of denaturation, (94°C for 1 min), annealing (55°C for 1 min) and, extension (72°C for 1 min) followed by final extension at 72°C for 10 min]. For expression analysis, RNA was extracted from fully developed 5^th leaf from bottom, 1week after second N fertilizer dose, by using Trizol Reagent (Invitrogen, U.S.A.) and cDNA was synthesized by Revert Aid reverse transcriptase (Fermentas, U.S.A.). Specific forward (AlaAT F) and reverse (AlaAT R) primers were used to confirm relative expression of co-AlaAT gene in transgenic lines through quantitative real time PCR analysis, whileprimer pair of 18SRNA gene was used as reference control to compare relative expression of co-AlaAT gene in different transgenic lines. Real-time PCR was performed for relative quantification of synthetic co-AlaAT gene in various transgenic and wild type control lines in 20 µL reaction mixtures containing 50 ng cDNA, 200 µM MgCl2, 200 nM of each primer and SYBR Green qPCR kit (Fermentas, USA) using CFX-96 real-time PCR machine (Biorad, USA.).

Studies on morpho-physiological and biochemical parameters of transgenic plants

Plant height of putative tobacco plants were measured at rapid vegetative growth and at maturity stage by plant height measuring scale. Leaf area of fully developed fifth leaf from bottom was measured through CI-202 Laser Area Meter (CID Bio-Sciences, U.S.A.). Stalk diameter was recorded with a diameter measuring tape. Shoot fresh/dry weights and root dry weights were recorded when plants were harvested and drying plants at 65ºC for 72 h in drying oven. Seed weight per plant of each tobacco line was determined using lab scale analytical balance.

Estimation of the total free amino acids was recorded by following Hamilton and Van Slyke (1943) method. Fresh leaf tissues (1.0 g) were taken 1 week after third N fertilizer dose, sliced in citrate buffer (10 mL; pH 5.0) and incubated at room temperature for 1 h. This mixture was centrifuged at 15,000 rpm for 10 min at 15ºC. The supernatant was taken carefully and used to quantify total free amino acids. One milliliter volume of the eluent was taken in a 20 mL test tube and 1 mL of ninhydrin solution was added. These tubes were kept wrapped in aluminum foil to avoid light contact and heated for 20 minutes at 100°C in a water bath. These tubes were then cooled down to room temperature and 5 mL of the diluent was mixed and incubated again for 15 min at room temperature. The optical density (OD) was measured at 570 nm on a UV-visible spectrophotometer (Hitachi-220, Japan).

The total nitrogen content of transgenic plant material 1 week after third N fertilizer dose was measured by following micro–Kjeldhal’s method (Bremner 1965). The tissue samples of tobacco plants were digested with sulfuric acid (5 mL) and transferred in Kjeldhal’s tubes before placing them in Kjeldhal’s ammonia distillation unit and 5 mL of 40% sodium hydroxide (NaOH) was added to every tube. Boric acid solution (5 mL) was taken in a conical flask with few drops of mixed indicator. When the distillate reached approximately 40 mL, stopped the distillation process and let the distillate cooled down for few minutes and titrated with 0.01 N standard H₂SO₄ till the solution turned pink. A blank control was run during the whole procedure. The values were taken three times for a single sample to rule out the possibility of analytical error.

N content was estimated by using the following formula

N (%) = (V₂-V₁) × N × 0.014 × 100

W

Where

V₂: Volume of H₂SO₄ used for sample during titration

V₁: Volume of H₂SO₄ used for blank control during titration

N: Normality of the acid used for titration

N%: Percent nitrogen

After estimation of total nitrogen content, the value of crude protein was calculated by multiplying the obtained data with a conversion factor of 6.25.

Alanine aminotransferase activity was measured 1 week after third N fertilizer dose from freshly harvested leaf tissues of transgenic and wild-type control (as described by McAllister and Good 2015). Harvested leaf samples equal to 5.0 g weight were ground with pestle and mortar by keeping them on ice with extraction buffer, a pinch of sand and Polyvinyl polypyrrolidone (PVPP) was added. The ground samples were centrifuged for 15 min at 15.7 relative centrifugal force. The supernatant from each replicate was column purified through Amicon Filter Column and AlaAT activity was assessed in a continuous coupled reaction catalyzed by lactate dehydrogenase and AlaAT. The change of absorbance due to the formation of NAD⁺ from NADH was monitored at 340 nm as reported by Miyashita et al. (2007).

Statistical analysis

Three putative transgenic tobacco lines along with wild-type controls were evaluated using CRD split block design with four N treatments (0, 75, 100 and 125 kg N/ha) in four replicates. The data was analyzed by two-way analysis of variance (ANOVA) using MS Excel. The data are means ± SD with P ≤ 0.05.

Results

Selection of regenerating putative transgenic plantlets

The putative transgenic tobacco (Nicotiana tabacum L.) plantlets having co-AlaAT gene were selected on media containing kanamycin 100 mg/L. The regeneration potential was found to be 72% while observed transformation efficiency was 49%. T₁-T₃ generations of transgenic tobacco lines were raised in pots under control conditions. Fifty T₃ seeds of homozygous transgenic tobacco lines and wild-type were germinated on MS₀ containing 100 mg/L kanamycin. After a week, it was found that SAC1, SAC2 and SAC5 showed 82, 87 and 78% kanamycin resistant seedlings whereas all wild-type seedlings showed kanamycin sensitivity. Further, genomic DNA was isolated from leaf tissues of putative transgenic as well as non-transgenic (control) plants by CTAB method (Doyle and Doyle 1987).

Molecular testing of co-AlaAT transgenic tobacco lines

Initial screening of putative transgenic plants was done by amplifying co-AlaAT gene specific fragment through PCR. Plasmid DNA was used as a positive (+ve) control while DNA from a non-transformed plant was used as the negative control. Amplification of gene specific 459 bp internal DNA fragment of the co-AlaAT gene indicated the successful transformation of this gene in five different transgenic lines (Fig. 1, Lanes 1–5). However, data of only three lines (SAC1, SAC2, and SAC5) were presented in this manuscript. No amplification was observed in the non-transformed control (Wt: wild-type).

Table 1: Primers used for PCR detection and real time quantification of co-AlaAT gene. AlaATAF/AlaAT BR primer pair was used for PCR detection of co-AlaAT gene in putative transgenic tobacco plants while AlaAT F/AlaAT R and 18S F/18S R primer pairs used for of co-AlaAT gene quantification in different transgenic tobacco lines

Primer Name	Primer Sequence (5’-3’)
AlaATAF	TACTCCGCCTCTATCGCACT
AlaAT BR	CCCTCACTGGAGCTGAAAAG
AlaAT F	TTCTCTCCCCTTTGACGAGA
AlaAT R	TGATCGCATAACGCTAGCAC
18S F	TCTGCCCTATCAACTTTCGATGGTA
18S R	AATTTGCGCGCCTGCTGCCTTCCTT

Fig. 1: Agarose gel electrophoresis showing the PCR amplification of 459 bp fragment of co-AlaAT gene from five independent transgenic events in tobacco. Lanes 1- 5 show gene amplification from SAC1, SAC2, SAC5, OAC2 and OAC3 transgenic plants (only first three lines described in this study), wt is a non-transformed negative control, +ve show gene amplification from plasmid control while M show 1 kb DNA ladder

Fig. 2: Relative quantification of co-AlaAT gene. Y-axis is representing Real Time PCR data using delta delta Ct (ddCt) method, while X-axis represents average fold change of co-AlaAT transcripts level in different transgenic (SAC1, SAC2 and SAC3) lines versus wild-type (Wt) control. No transcripts of co-AlaAT gene detected in wild-type tobacco plants

RT-PCR detection system (CFX96, Biorad USA) was used to quantify transgene expression in different transgenic tobacco lines. The acquired data was normalized with 18S housekeeping reference gene. No expression of co-AlaAT gene was detected in wild-type (Wt) control, while the transgenic line SAC2 showed highest expression (4X higher expression than SAC1) followed by SAC1 and SAC5 (Fig. 2).

Synthetic co-AlaAT gene triggers morpho-physiological alterations in transgenic plants

Selected transgenic tobacco lines were evaluated at 0, 75, 100 and 125 kg N/ha (N0, N75, N100 and N125) fertilizer doses through different molecular, morpho-physiological and biochemical means. Various morpho-physiological attributes like plant height, leaf area, stalk diameter, fresh mass, dry mass and seed weight/plant were recorded and analyzed through two factor ANOVA of Microsoft Excel2010 (Fig. 3A–F). The values are mean of four replicates of tested transgenic lines at different nitrogen regimes. Plant heights of wild type control plants were significantly higher (at P < 0.001) than transgenic plants under all nitrogen fertilizer doses at rapid vegetative growth (Fig. 3A). However, upon reaching at maturity stage, plant height of wild type and transgenic plants differ non-significantly. The differences in the leaf area of fully developed (fifth) leaf of transgenic and control (non-transformed) tobacco plants (Fig. 3B and 5) were measured. At different N fertilizer regimes, transgenic plants showed significantly higher leaf area than wild-type control. The leaf area of control plants (Fig. 3B) was significantly lower than that of all transgenic lines at N0 fertilizer application. SAC1 and SAC2 possessed highest leaf area at N0 and N75. However, SAC2 and SAC5 showed more leaf area at N100 and N125 fertilizer dose but increase in leaf area beyond N75 remained non-significant (Fig. 3B).

Stalk diameter of SAC2 and SAC5 were significantly higher from SAC1 and wild-type at N0, N75, and N100 fertilizer dose while the stalk diameter of SAC1 was significantly greater than SAC2 and wild-type at N125 fertilizer level (Fig. 3C). Fresh mass of SAC1 and SAC2 were significantly higher from wild-type and SAC5 at N0 fertilizer regime, however the fresh mass of all three transgenic lines was significantly higher than wild-type control plants at N75 fertilizer dose. At N100 and N125 fertilizer level, SAC1 and SAC2 retained significantly more fresh mass than SAC5 and wild-type control (Fig. 3D).

Dry mass value of SAC2 was statistically higher from SAC1, SAC5 and wild-type control at N0 nitrogen fertilizer dose. Whereas dry mass values of SAC1 and SAC2 were statistically higher than SAC5 and wild-type control at N75. However, dry mass values of all transgenic lines remained significantly higher than wild type at N100 and N125 nitrogen regimes (Fig. 3E). Seed weight of SAC2was statistically higher than SAC1, SAC5 and wild type at N0 fertilizer dose, while seed weight of all transgenic lines were significantly higher from wild-type at N75, N100 and N125 fertilizer environment (Fig. 3F).

Synthetic co-AlaAT gene insertion elicit biochemical changes in transgenic plants

Data of different biochemical parameters like total free amino acid, total nitrogen contents, crude protein and alanine aminotransferase activity was measured (Fig. 4A–D). The experiment was repeated three times from year 2015–2017. The total free amino acids of SAC1, SAC2, and SAC5 were significantly higher than wild-type control at N0, N75, N100 and N125 fertilizer dose. However, level of total free amino acids was statistically similar in SAC1 and SAC5 but varied significantly with respect to SAC2 at all fertilizer regimes (Fig. 4A). Total nitrogen content value at N0 fertilizer level was non-significant between wild-type and SAC1 but its values began to increase with the increase of nitrogen fertilizer application. The total nitrogen content of SAC1, SAC2, and SAC5 was significantly higher than wild-type at N75, N100 and N125 fertilizer level. However, SAC2 attained significantly higher nitrogen content than SAC1 and SAC5 at all nitrogen fertilizer applications. Total nitrogen content values reached to a maximum at N75 fertilizer regime in case of SAC2 but varied non-significantly at higher N fertilizer doses (Fig. 4B).

Fig. 3: Morpho-physiological assessment of; A. Plant height, B. Leaf area (fifth leaf from bottom), C. Stalk diameter, D. Fresh mass, E. Dry mass, F. Seed weight of wild-type (Wt) and putative transgenic co-AlaAT tobacco lines (SAC1, SAC2 and SAC3) at N0, N75, N100, N125 kg/ha N fertilizer doses

Fig. 4: Biochemical evaluation of; A. Total free amino acids, B. Total nitrogen content, C. Crude proteins, D. AlaAT activity of wild-type (Wt) and putative transgenic co-AlaAT tobacco lines (SAC1, SAC2 and SAC3) at N0, N75, N100, N125 kg/ha N fertilizer doses

SAC2 and SAC5 varied significantly from each other and had significantly higher crude proteins than SAC1 and wild-type at N0 fertilizer dose. Similarly, SAC1, SAC2 and SAC5 possessed significantly more crude protein than wild-type at N75, N100 and N125 fertilizer level (Fig. 4C). Alanine aminotransferase activity of different transgenic lines was calculated at various nitrogen fertilizer exposure levels. All the transgenic lines possessed significantly higher alanine aminotransferase activity than wild-type control at all fertilizer levels. However, highest AlaAT activity was measured in SAC1, SAC2 and SAC5 lines at N75. Then its activity tends to be decreasing at N100 and N125fertilizer doses. Lowest level of alanine aminotransferase activity was observed at N125 nitrogen regime in all transgenic and wild-type lines, even then the level of AlaAT activity of all the transgenic lines was significantly higher than wild-type plants at said fertilizer dose (Fig. 4D).

Discussion

In an effort to improve nitrogen use efficiency (NUE) in crop plants, a synthetic codon optimized co-AlaAT gene was used in this study. Codon optimized alanine aminotransferase (co-AlaAT) gene was introduced and overexpressed under 2XCaMV35S promoter in tobacco (Nicotiana tabacum L.). Putative transgenic tobacco (T₃) lines having optimum expression of co-AlaAT was used for evaluation under different N fertilizer regimes. The over-expression of co-AlaAT gene and AlaAT enzymatic activity resulted in significant increase in leaf area, stalk diameter, fresh and dry masses, root dry weight and seed weight/plant as compared to non-transformed wild-type control under various N fertilizer doses. Pena et al. (2017) reported that transformation of HvAlaAT gene driven by constitutive and root specific promoter in wheat and sorghum, exhibited higher alanine aminotransferase (Alt) activity. Increased Alt activity influenced boosting of vegetative biomass, tillering and plant height relative to wild type wheat plants under hydroponic environment. However, wild type plants in case of tobacco, were using available N for increasing their heights during rapid vegetative growth stage at different N fertilizer applications. Nevertheless, putative transgenic tobacco plants tend to accumulate and assimilate more N which was depicted in enhanced leaf area, stalk diameter and biomass produce. These results corroborate when HvAlaAT gene was expressed under OsANT1 tissue-specific promoter in rice, wheat and sorghum (Shrawat et al. 2008; Pena et al. 2017). A comparison of 2XCaMV35S: co-AlaAT tobacco plants indicated that over-expression of co-AlaAT gene showed association with the increase in leaf area, stalk diameter, fresh/dry mass produce (Fig. 3A-F) at N0, N75, N100 and N125 nitrogen fertilizer applications. Contrary to higher expression values of inserted gene some time does not result in the desired phenotype, in case of sorghum transformed with HvAlaAT, displayed higher alt activity but no or little phenotypic changes were observed (Pena et al. 2017). The differences in values for these attributes in transgenic plants were prominent under low level of nitrogen (N75) supply, whereas no or little differences were observed under high nitrogen fertilizer applications (Shrawat et al. 2008; Snyman et al. 2015). It is indicated that under optimal and overdose of N amendments (N100 and N125), the phenotypic and biochemical differences were minimum (Good et al. 2007). Lines SAC1, SAC2 and SAC5 exhibited highest amino acid, total N content, crude proteins and AlaAT activity (Fig. 4A-D), which represented direct association with the moderate to the highest expression of co-AlaAT gene as investigated in sugarcane expressing HvAlaA Tgene (Snyman et al. 2015). In these transgenic tobacco lines synthetic co-AlaAT finally resulted to improve nitrogen uptake, metabolism, assimilation, nutrient use efficiency, phenotypic traits (McAllister and Good 2015; Snyman et al. 2015) and biochemical attributes (Beatty et al. 2013; Pena et al. 2017). It has been demonstrated that AlaAT activity is involved in the production of either pyruvate or alanine for maintaining carbon-nitrogen balance (Miyashita et al. 2007) and control seed dormancy in the plant kingdom (Sato et al. 2016). Pena et al. (2017) confirmed that vegetative biomass, grain yield, and nitrogen contents in wheat were enhanced by over-expression of HvAlaAT gene under the control of root-specific and constitutive promoter. In this pot experiment, transgenic tobacco plants sustained significantly higher biomass as compared to wild-type control and resulted in 25-30% decrease in nitrogen fertilizer requirement without causing any yield penalty as observed in case of HvAlaAT transgenic sugarcane pot experiment (Snyman et al. 2015). The results of expressing synthetic co-AlaAT in tobacco revealed many similar physiological, molecular and biochemical attributes as observed in transgenic canola, rice, wheat and sorghum (Good et al. 2007; Shrawat et al. 2008; Pena et al, 2017).

The increased fresh and dry biomass was evident from their high values for leaf area, stalk diameter, fresh/dry biomass, seed weight (Fig. 3B-F), root dry mass and less internodal distance (data not shown here) values. It is implicated that reduced internodal distance in SAC2 and SAC5 as compared to wild-type might be due to co-AlaAT gene over-expression for speedy translocation of essential nutrients from root to shoot. Root structure and size is an important parameter for ensuring efficient nutrient supply to various parts of shoot system. Transgenic tobacco plants retained densely arranged root system. SAC1, SAC2, and SAC5 possessed bushier, more lateral root proliferation, finer roots and root hairs as compared to wild-type (data not shown). Finer roots are reported to have more surface area to volume ratio as compared to thick root and plants nitrogen uptake is dependent on location, size and number of root hairs (Snyman et al. 2015). It has been observed that availability of nitrate may interfere with the location and number of lateral root initiation sites (Malamy and Ryan 2001).

Transgenic tobacco revealed a significant increase in total free amino acid, nitrogen content, crude protein, and alanine aminotransferase activity. An increase in nitrogen flow was observed from Glutamine, Glutamate and Alanine when barley AlaAT gene expressed under the root-specific promoter in Brassica napus (Good et al. 2007). These amino acids are translocated to xylem sap immediately and trigger the plant growth. It is true for transgenic tobacco transformed with the co-AlaAT gene. Increase in alanine aminotransferase activity significantly increases the amount of total free amino acid, crude protein and total nitrogen content in transgenic lines (Pena et al. 2017). In shoot tissues an increase in the level of certain amino acids like Glutamate, Glutamine and Aspartic acid could be utilized as available nitrogen pool for the creation of nitrogen-containing compounds or other amino acids (Shrawat et al. 2008). Glutamine (Gln) is proposed to play a central role as a possible signaling molecule and in amino acid metabolism. Synthetic co-AlaAT gene could play a vital role in starch synthesis under hypoxic or limited N condition (Yang et al. 2015).

SAC1, SAC2 and SAC5 lines confirmed significant improvement in N efficient phenotype when compared with wild-type control. Prominent N efficient phenotype was observed in transgenic lines SAC1 and SAC2 under limited N (N0 and N75) supply, indicating their efficiency to uptake available N while SAC2 and SAC5 were performing better at higher N doses (N100 and N125) indicated their responsiveness to optimal or overdoses. These results are promising and support the application of transgenic approaches for improvement of nitrogen use efficiency in crop plants which could reduce the fertilizers input cost, increase the profitability in term of yield and decrease the environmental damage or probable risk to human health due to nitrates toxicity (Ahmed et al. 2017).

Optimal and efficient use of N fertilizer by plants is important to increase crop yield, to reduce fertilizers application and their hazardous impact on environment. The over-expression of co-AlaAT gene enhances the N uptake, translocation and mobilization. It is therefore assumed that synthetic co-AlaAT gene could be transformed in major crop plants to enhance their N efficient phenotype. However, N efficient phenotype is a complex and multifactorial trait might be influenced by genetic, environmental and climatic change. Therefore, vigilant precautions should be considered upon evaluation of selected lines. As enhanced AlaAT activity exhibited N efficient phenotypes in transgenic wheat lines but Alt activity did not translate to significant phenotypic effects in sorghum when transformed with HvAlaAT gene (Pena et al. 2017). Therefore, it is assumed that synthetic biology tools could help to achieve desired results in required crop plants.

Conclusion

Alanine aminotransferase (AlaAT) is an important metabolic pathway gene for nitrogen acquisition, translocation and metabolization in plants. Over-expression of synthetic codon optimized alanine aminotransferase gene under double strength of constitutive (2xCaMV35S) promoter in tobacco resulted in various morphological, physiological and biochemical changes in stably transformed plants. It has been envisaged that synthetic alanine aminotransferase gene could be used to achieve improvement of crop productivity and yield enhancement under limited N fertilizer application.

References

Ahmed M, M Rauf, Z Mukhtar, NA Saeed (2017). Excessive use of nitrogenous fertilizers: an unawareness causing serious threats to environment and human health. Environ Sci Pollut Res 24:26983‒26987

Araus V, EA Vidal, T Puelma, S Alamos, D Mieulet, E Guiderdoni, RA Gutierrez (2016). Members of BTB family of scaffold proteins suppress nitrate uptake and nitrogen use efficiency. Plant Physiol 171:1523‒1532

Beatty PH, RT Carrol, AK Shrawat, D Guevara, AG Good (2013). Physiological analysis of nitrogen efficient rice overexpressing alanine aminotransferase under different N regimes. Botany 91:866‒883

Bremner JM (1965). Total Nitrogen. Methods of soil analysis Part 2. In: Chemical and Microbial Properties, pp: 1049‒117. Black CA (eds.). Number 9 in series Agronomy. American Society of Agronomy, Inc. Publisher, Madison, Wisconsin, USA

Chen J, X Fan, K Qian, Y Zhang, M Song, Y Liu, G Xu, X Fan (2017). pOsNAR2.1: OsNAR2.1 expression enhances nitrogen uptake efficiency and grain yield in transgenic rice plants. Plant Biotechnol J 15:1273‒1283

Doyle JJ, JL Doyle (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19:11‒15

Garnett T, D Plett, S Heuer, M Okamoto (2015). Genetic approaches to enhance nitrogen use efficiency (NUE) in cereals: challenges and future directions. Funct Plant Biol 42:921‒941

Good AG, SJ Johnson, SD Pauw, RT Carrol, N Savidov, J Vidmar, Z Lu, G Taylor, V Stroeher (2007). Engineering nitrogen use efficiency with alanine aminotransferase. Can J Bot 85:252‒262

Good AG, AK Shrawat, DG Muench (2004). Can less yield more? Is reducing nutrient input into the environment compatible with maintaining crop production? Trends Plant Sci 9:597‒605

Hamilton PB, DDV Slyke (1943). The gasometric determination of free amino acids in blood filtrates by the ninhydrin-carbon dioxide method. J Biol Chem 150:231‒250

Kraiser T, DE Gras, AG Gutie´rrez, B Gonza´lez, RA Gutie´rrez (2011). A holistic view of nitrogen acquisition in plants. J Exp Bot 62:1455‒1466

Krapp A, IC David, C Chardin, TM Girin, A armagne, AS Leprince, S Chaillou, S Ferrario-Mery, F Daniel-Vedele (2014). Nitrate transport and signaling in Arabidopsis. J Exp Bot 65:789‒798

Malamy JE, KS Ryan (2001). Environmental regulation of lateral root initiation in Arabidopsis. Plant Physiol 127:899‒909

McAllister CH, AG Good (2015). Alanine aminotransferase variants conferring diverse NUE phenotypes in Arabidopsis thaliana. PLoS One, 10; Article e0121830

McAllister CH, PH Beatty, AG Good (2012). Engineering nitrogen use efficient crop plants: the current status. Plant Biotechnol J 10:1011‒1025

Miyashita Y, R Dolferus, P Ismond, AG Good (2007). Alanine aminotransferase catalyses the breakdown alanine after hypoxia in Arabidopsis thaliana. Plant J 49:1108‒1121

Mu X, F Chen, Q Wu, Q Chen, J Wang, I Yuan, G Mi (2015). Genetic improvement of root growth increases maize yield via enhanced post silking nitrogen uptake. Eur J Agron 63:55‒61

Murashig T, F Skoog (1962). A revised medium for rapid growth and bio assays with tobacco tissue cultures. Plant Physiol 15:473‒499

Pena PA, T Quach, S Sato, Z Ge, N Nersesian, IM Dweikat, M Soundararajan, TE Clement (2017). Molecular and phenotypic characterization of transgenic wheat and sorghum events expressing the barley alanine aminotransferase. Planta 246:1097‒1107

Santiago JP, M Tegede (2016). Connecting source with sink: the role of Arabidopsis AAP8 in phloem loading of amino acids. Plant Physiol 171:508‒521

Sato K, M Yamane, N Yamaji, H Kanamori, A Tagiri, GJ Schwerdt, BG Fincher, T Matsumoto, K Takeda, T Komatsuda (2016). Alanine aminotransferase controls seed dormancy in barley. Nat Commun 10; Article 11625

Shrawat AK, RT Carrol, MD Pauw, J Gregory, G Taylor, AG Good (2008). Genetic engineering of improved nitrogen use efficiency in rice by the tissue specific expression of alanine aminotransferase. Plant Biotechnol J 6:722‒732

Snyman SJ, E Hajari, MP Watt, Y Lu, JC Kridl (2015). Improved nitrogen use efficiency in transgenic sugarcane: Phenotypic assessment in a pot trial under low nitrogen conditions. Plant Cell Rep 34:667‒669

Tegeder M (2014). Transporters involved in source to sink partitioning of amino acids and ureides: opportunities for crop improvement. J Exp Bot 65:1865‒1878

Yang J, SR Kim, SK Lee, H Choi, JS Jeon (2015). Alanine aminotransferase1 (OsAlaAT1) plays an essential role in the regulation of starch storage in rice endosperm. Plant Sci 240:79‒89

Zhang I, MG Garneau, R Majumdar, J Grant, M Tegeder (2015). Improvement of pea biomass and seed productivity by simultaneous increase of phloem and embryo loading with amino acids. Plant J 81:134‒146

Zhu S, JM Vivanco, DK Manter (2016). Nitrogen fertilizer rate affects root exudation, the rhizosphere microbiome and nitrogen use efficiency of maize. Appl Soil Ecol 107:324‒333