Introduction
With
the advancement in plant molecular biology, synthetic biological approaches are
being used routinely to improve crop productivity. Since last 50 years, N
fertilizers are being used quite extensively to enhance or to sustain crop
yield (McAllister et al. 2012).
Although N is an essential element but usually it becomes limiting nutrient for
plant growth and development due to leaching of nitrate and volatilization
process (Kraiser et
al. 2011; Garnett et al. 2015).
Only 30–50% of applied N is taken up by plants while the remaining is lost
through ammonia volatilization, surface runoff, consumed by soil microbes and
by nitrate leaching (Yang et al.
2015; Zhu et al. 2016).
The excessive use of N fertilizer cause imbalance of other essential
nutrients necessary for optimum plant growth, contribute toward greenhouse gas
emission, nitrate accumulation in underground water used for drinking and cause
serious threats to human health (Ahmed et
al. 2017). This situation urges the strong demand for the development of
nitrogen use efficient crops. Strategies to improve nitrogen use efficiency
(NUE) in plants focused mainly upon genetic manipulation for enhancement of N
uptake (Araus et
al. 2016; Chen et al. 2017),
nitrate translocation, N metabolism (Pena et
al. 2017) and its regulation. Although, these approaches are generally
successful but NUE additionally depends upon N partitioning within plant and
efficiency of nitrate or associated amino acid transporters (Mu et al. 2015).
During vegetative growth, plants utilize N in three steps: uptake,
translocation, and assimilation. Nitrate and ammonium are the major forms of
inorganic N present in agricultural soil (Krapp et al. 2014). Nitrate is the main form
of N consumed by many plant species. When nitrate enters the plant cell, it is
reduced to nitrite by Nitrate Reductase (NR). Nitrite is transported further to
plastids where it undergoes reduction process and converted to ammonia by
nitrite reductase. Ammonia then enters the GOGAT (glutamine-oxoglutarate
aminotransferase) cycle and transformed to glutamine and glutamate (Santiago
and Tegeder 2016). The amino group of glutamate could
then be transferred to various amino acids by different aminotransferases (Tegeder 2014). Alanine aminotransferase catalyzes the
reversible conversion of alanine and 2-oxoglutarate to pyruvate and glutamate.
Alanine is an important amino acid for various reasons (Good et al. 2007; Shrawat
et al. 2008) e.g., it is
usually excreted by N fixing bacteria and then assimilated into plant roots
(Zhang et al. 2015), suggesting its
role in organic N metabolism. Additionally, under certain stresses, alanine has
been found to be among the major storage amino acids (Good et al. 2007). In most of the cases, 50–75% of applied N to arable
lands is utilized by microorganisms or lost through leaching (Yang et al. 2015; Zhu et al. 2016). So the improvement in plant nitrogen use efficiency
through genetic engineering has been the focus of research since last decade.
Over-expression of barley alanine
aminotransferase (AlaAT) gene in canola
and rice has been demonstrated with improved nitrogen use efficiency as
indicated by measured biomass and grain yield under low nitrogen supply (0.5–4.0
mM) in growth chambers, hydroponics and field
trials (Good et al. 2004; Shrawat et al.
2008). A nitrogen efficient phenotype was observed in transgenic rice
transformed with barley (HvAlaAT) gene and
assessed physiologically under low, medium and high N supply (Beatty et al. 2013). Similarly, transgenic
sugarcane, wheat and sorghum expressing HvAlaAT
gene were developed and assessed under low nitrogen supply, hydroponics and
greenhouse experiments respectively, indicated improvement in nitrogen use
efficiency (Snyman et al. 2015; Pena et al. 2017). However, codon
optimization of barley alanine
aminotransferase (AlaAT) gene by replacing
less frequently predicted codons with most favored codons to achieve optimal
transcriptional efficiency and translational ability in tobacco (Nicotiana
tabacum L.) plants (dicot) is used for the first time to be expressed under
2XCaMV35S promoter. It was hypothesized that introduction of synthetic AlaAT gene could be an effective approach to attain
optimal expression level in the targeted plant species.
Materials and Methods
Cloning in binary vector and transformation of tobacco
Barley
alanine aminotransferase gene
(Accession no. Z26322) was codon optimized by replacing codon predicted to be
less frequently use in tobacco with more favored codons according to Codon
Usage Database (http://www.kazusa.or.jp). Codon optimization was performed by
keeping in view a range of factors involved in protein expression, codon
adaptability, mRNA structure, various cis-elements in transcription and
translation to have optimum transcriptional competence, translational
efficiency and protein folding in tobacco (Nicotian
atabacum L.) plants. The codon optimized (co-AlaAT)
gene along with the introduction of HindIII
and EcoRI restriction sites was got
synthesized commercially from M/S Eurofins Genomics,
USA anddelivered in general plasmid vector (pBluescript). The
pBluescript
plasmid was restricted with HindIII and EcoRI restriction enzymes to ligate the codon
optimized alanine aminotransferase
(co-AlaAT) gene (1453 bp) into pJIT60 vector
under 2XCaMV35S promoter and CaMV
terminator. Then pJIT60 vector having
the whole cassette (2XCaMV35S- co-AlaAT-
CaMV) was digested with KpnI and XhoI hexa
cutter enzymes and sub-cloned the complete cassette in a pGreen0029 binary vector by using the same restriction sites. This
construct was transformed into Agrobacterium tumefaciens strain ‘LBA4404’
through electroporation method. Freshly cut tobacco leaf discs were inoculated
with Agrobacterium culture and incubated on MS0 medium (Murashig and Skoog 1962). After
shoot and root development, the regenerated plants were transplanted to the
soil in pots and three PCR positive putative transgenic lines were selected to
raise T1, T2, and T3 generations.
Evaluation of putative transgenic tobacco lines at
different N fertilizer regimes
The
PCR positive lines were selected to be tested further during 2017–2018 on the
basis of their performance at different nitrogen regimes. The selected lines i.e.,
SAC1, SAC2, and SAC5 were grown in four replicates in pot experiments. Sandy
loom soil was weighed to 30 kg/pot of 12’ internal diameter x 14’ height and two
tobacco seedlings were transplanted in each pot. Upon suitable settlement of
young seedling, one plant/pot was retained for further experimentation.
Different N regimes were created by applying urea as N fertilizer at the rate
of 0, 75, 100 and 125 kg N/ha and represented as N0, N75, N100 and N125
respectively. Urea fertilizer was applied in three split applications at
transplantation, vegetative growth phase and flowering stage. The other
fertilizers i.e., phosphorous and potassium were applied ten days after
sowing at a rate of 75 kg/ha P2O5 and 50 kg/ha K2O.
Molecular analysis of putative transgenic tobacco
lines
DNA
was extracted from leaf tissues of putative transgenic tobacco plants by CTAB
method (Doyle and Doyle 1987) and tested for codon optimized alanine aminotransferase (co-AlaAT)
gene insertion in tobacco genome by PCR. Gene-specific primers (Table 1) were
used to amplify co-AlaAT gene with the forward
(AlaAT AF) and reverse (AlaAT
BR) primers in a PCR reaction of 50 µL volume containing 100 ng plant
DNA, 200 µM MgCl2, 200 nM of each primer and 25
µL Dream Taq Green Mix (Fermentas,
U.S.A.). The profile used for PCR reaction consisted of [Initial denaturation
temperature 94°C for 4 min; 35 cycles of denaturation, (94°C for 1 min),
annealing (55°C for 1 min) and, extension (72°C for 1 min) followed by final
extension at 72°C for 10 min]. For expression analysis, RNA was extracted from
fully developed 5th leaf from bottom, 1week after second N
fertilizer dose, by using Trizol Reagent (Invitrogen,
U.S.A.) and cDNA was synthesized by Revert Aid reverse transcriptase (Fermentas, U.S.A.). Specific forward (AlaAT
F) and reverse (AlaAT R) primers were used to
confirm relative expression of co-AlaAT gene
in transgenic lines through quantitative real time PCR analysis, whileprimer pair of 18SRNA
gene was used as reference control to compare relative expression of co-AlaAT gene in different transgenic lines. Real-time
PCR was performed for relative quantification of synthetic co-AlaAT gene in various transgenic and wild type
control lines in 20 µL reaction mixtures containing 50 ng cDNA, 200 µM
MgCl2, 200 nM of each primer and SYBR Green qPCR kit (Fermentas, USA) using
CFX-96 real-time PCR machine (Biorad, USA.).
Studies
on morpho-physiological and biochemical parameters of transgenic plants
Plant height of putative tobacco plants were measured at
rapid vegetative growth and at maturity stage by plant height measuring scale.
Leaf area of fully developed fifth leaf from bottom was measured through CI-202
Laser Area Meter (CID Bio-Sciences, U.S.A.). Stalk diameter was recorded with a
diameter measuring tape. Shoot fresh/dry weights and root dry weights were
recorded when plants were harvested and drying plants at 65şC for 72 h in
drying oven. Seed weight per plant of each tobacco line was determined using
lab scale analytical balance.
Estimation of the total free amino acids
was recorded by following Hamilton and Van Slyke (1943) method. Fresh leaf
tissues (1.0 g) were taken 1 week after third N fertilizer dose, sliced in
citrate buffer (10 mL; pH 5.0) and incubated at room temperature for 1 h. This
mixture was centrifuged at 15,000 rpm for 10 min at 15şC. The supernatant was
taken carefully and used to quantify total free amino acids. One milliliter
volume of the eluent was taken in a 20 mL test tube and 1 mL of ninhydrin
solution was added. These tubes were kept wrapped in aluminum foil to avoid
light contact and heated for 20 minutes at 100°C in a water bath. These tubes
were then cooled down to room temperature and 5 mL of the diluent was mixed and
incubated again for 15 min at room temperature. The optical density (OD) was
measured at 570 nm on a UV-visible spectrophotometer (Hitachi-220, Japan).
The total nitrogen content of transgenic
plant material 1 week after third N fertilizer dose was measured by following
micro–Kjeldhal’s method (Bremner
1965). The tissue samples of tobacco plants were digested with sulfuric acid (5
mL) and transferred in Kjeldhal’s tubes before
placing them in Kjeldhal’s ammonia distillation unit
and 5 mL of 40% sodium hydroxide (NaOH) was added to every tube. Boric acid
solution (5 mL) was taken in a conical flask with few drops of mixed indicator.
When the distillate reached approximately 40 mL, stopped the distillation
process and let the distillate cooled down for few minutes and titrated with
0.01 N standard H2SO4 till the solution turned pink. A
blank control was run during the whole procedure. The values were taken three
times for a single sample to rule out the possibility of analytical error.
N
content was estimated by using the following formula
N (%)
= (V2-V1) × N × 0.014 × 100
W
Where
V2:
Volume of H2SO4 used for sample during titration
V1:
Volume of H2SO4 used for blank control during titration
N:
Normality of the acid used for titration
N%:
Percent nitrogen
After
estimation of total nitrogen content, the value of crude protein was calculated
by multiplying the obtained data with a conversion factor of 6.25.
Alanine aminotransferase activity was
measured 1 week after third N fertilizer dose from freshly harvested leaf
tissues of transgenic and wild-type control (as described by McAllister and
Good 2015). Harvested leaf samples equal to 5.0 g weight were ground with
pestle and mortar by keeping them on ice with extraction buffer, a pinch of
sand and Polyvinyl polypyrrolidone (PVPP) was added. The ground samples were centrifuged for 15 min at
15.7 relative centrifugal force. The supernatant from each replicate was column
purified through Amicon Filter Column and AlaAT activity was assessed in a continuous coupled
reaction catalyzed by lactate dehydrogenase
and AlaAT. The change of absorbance due to the
formation of NAD+ from NADH was monitored at 340 nm as reported by
Miyashita et al. (2007).
Statistical analysis
Three
putative transgenic tobacco lines along with wild-type controls were evaluated
using CRD split block design with four N treatments (0, 75, 100 and 125 kg
N/ha) in four replicates. The data was analyzed by two-way analysis of variance
(ANOVA) using MS Excel. The data are means ± SD with P ≤ 0.05.
Results
Selection of regenerating putative transgenic
plantlets
The
putative transgenic tobacco (Nicotiana tabacum L.) plantlets having co-AlaAT gene were
selected on media containing kanamycin 100 mg/L. The regeneration potential was
found to be 72% while observed transformation efficiency was 49%. T1-T3
generations of transgenic tobacco lines were raised in pots under control
conditions. Fifty T3 seeds of homozygous transgenic tobacco lines
and wild-type were germinated on MS0 containing 100 mg/L kanamycin.
After a week, it was found that SAC1, SAC2 and SAC5 showed 82, 87 and 78%
kanamycin resistant seedlings whereas all wild-type seedlings showed kanamycin
sensitivity. Further, genomic DNA was isolated from leaf tissues of putative
transgenic as well as non-transgenic (control) plants by CTAB method (Doyle and
Doyle 1987).
Molecular
testing of co-AlaAT transgenic tobacco lines
Initial
screening of putative transgenic plants was done by amplifying co-AlaAT gene
specific fragment through PCR. Plasmid DNA was used as a positive (+ve) control while DNA from a non-transformed plant was used
as the negative control. Amplification of gene specific 459 bp internal DNA
fragment of the co-AlaAT gene indicated the
successful transformation of this gene in five different transgenic lines (Fig.
1, Lanes 1–5). However, data of only three lines (SAC1, SAC2, and SAC5) were
presented in this manuscript. No amplification was observed in the
non-transformed control (Wt: wild-type).
Table 1: Primers used for PCR detection
and real time quantification of co-AlaAT gene. AlaATAF/AlaAT BR primer
pair was used for PCR detection of co-AlaAT gene in putative transgenic tobacco plants while AlaAT F/AlaAT R and 18S F/18S R primer pairs used for of co-AlaAT gene quantification in
different transgenic tobacco lines
Primer Name |
Primer Sequence (5’-3’) |
AlaATAF |
TACTCCGCCTCTATCGCACT |
AlaAT BR |
CCCTCACTGGAGCTGAAAAG |
AlaAT F |
TTCTCTCCCCTTTGACGAGA |
AlaAT R |
TGATCGCATAACGCTAGCAC |
18S F |
TCTGCCCTATCAACTTTCGATGGTA |
18S R |
AATTTGCGCGCCTGCTGCCTTCCTT |
Fig. 1: Agarose gel electrophoresis
showing the PCR amplification of 459 bp fragment of
co-AlaAT
gene from five independent transgenic events in tobacco. Lanes 1- 5 show gene
amplification from SAC1, SAC2, SAC5, OAC2 and OAC3 transgenic plants (only
first three lines described in this study), wt is a
non-transformed negative control, +ve show gene
amplification from plasmid control while M show 1 kb DNA ladder
Fig. 2: Relative quantification of co-AlaAT gene. Y-axis is
representing Real Time PCR data using delta delta Ct
(ddCt) method, while X-axis represents average fold
change of co-AlaAT
transcripts level in different transgenic (SAC1, SAC2 and SAC3) lines versus
wild-type (Wt) control. No transcripts of co-AlaAT gene
detected in wild-type tobacco plants
RT-PCR detection system (CFX96, Biorad USA)
was used to quantify transgene expression in different transgenic tobacco
lines. The acquired data was normalized with 18S housekeeping reference gene. No expression of co-AlaAT gene was detected in wild-type (Wt) control, while the transgenic line SAC2 showed highest
expression (4X higher expression than SAC1) followed by SAC1
and SAC5 (Fig. 2).
Synthetic
co-AlaAT gene triggers morpho-physiological
alterations in transgenic plants
Selected
transgenic tobacco lines were evaluated at 0, 75, 100 and 125 kg N/ha (N0, N75,
N100 and N125) fertilizer doses through different molecular,
morpho-physiological and biochemical means. Various morpho-physiological
attributes like plant height, leaf area, stalk
diameter, fresh mass, dry mass and seed weight/plant were recorded and analyzed
through two factor ANOVA of Microsoft Excel2010 (Fig. 3A–F). The values are
mean of four replicates of tested transgenic lines at different nitrogen
regimes. Plant heights of wild type control plants were significantly higher
(at P < 0.001) than transgenic plants under all nitrogen fertilizer
doses at rapid vegetative growth (Fig. 3A). However, upon reaching at maturity
stage, plant height of wild type and transgenic plants differ
non-significantly. The differences in the leaf area of fully developed (fifth)
leaf of transgenic and control (non-transformed) tobacco plants (Fig. 3B and 5)
were measured. At different N fertilizer regimes, transgenic plants showed
significantly higher leaf area than wild-type control. The leaf area of control
plants (Fig. 3B) was significantly lower than that of all transgenic lines at
N0 fertilizer application. SAC1 and SAC2 possessed highest leaf area at N0 and
N75. However, SAC2 and SAC5 showed more leaf area at N100 and N125 fertilizer
dose but increase in leaf area beyond N75 remained non-significant (Fig. 3B).
Stalk diameter of SAC2 and SAC5 were
significantly higher from SAC1 and wild-type at N0, N75, and N100 fertilizer
dose while the stalk diameter of SAC1 was significantly greater than SAC2 and
wild-type at N125 fertilizer level (Fig. 3C). Fresh mass of SAC1 and SAC2 were
significantly higher from wild-type and SAC5 at N0 fertilizer regime, however
the fresh mass of all three transgenic lines was significantly higher than
wild-type control plants at N75 fertilizer dose. At N100 and N125 fertilizer
level, SAC1 and SAC2 retained significantly more fresh mass than SAC5 and
wild-type control (Fig. 3D).
Dry mass value of SAC2 was statistically
higher from SAC1, SAC5 and wild-type control at N0 nitrogen fertilizer dose.
Whereas dry mass values of SAC1 and SAC2 were statistically higher than SAC5
and wild-type control at N75. However, dry mass values of all transgenic lines
remained significantly higher than wild type at N100 and N125 nitrogen regimes
(Fig. 3E). Seed weight of SAC2was statistically higher than SAC1, SAC5 and wild
type at N0 fertilizer dose, while seed weight of all transgenic lines were
significantly higher from wild-type at N75, N100 and N125 fertilizer
environment (Fig. 3F).
Synthetic
co-AlaAT gene insertion elicit biochemical
changes in transgenic plants
Data
of different biochemical parameters like total free amino acid, total nitrogen
contents, crude protein and alanine aminotransferase activity was measured (Fig.
4A–D). The experiment was repeated three times from year 2015–2017. The total
free amino acids of SAC1, SAC2, and SAC5 were significantly higher than
wild-type control at N0, N75, N100 and N125 fertilizer dose. However, level of
total free amino acids was statistically similar in SAC1 and SAC5 but varied
significantly with respect to SAC2 at all fertilizer regimes (Fig. 4A). Total
nitrogen content value at N0 fertilizer level was non-significant between wild-type
and SAC1 but its values began to increase with the increase of nitrogen
fertilizer application. The total nitrogen content of SAC1, SAC2, and SAC5 was
significantly higher than wild-type at N75, N100 and N125 fertilizer level.
However, SAC2 attained significantly higher nitrogen content than SAC1 and SAC5
at all nitrogen fertilizer applications. Total nitrogen content values reached
to a maximum at N75 fertilizer regime in case of SAC2 but varied
non-significantly at higher N fertilizer doses (Fig. 4B).
Fig. 3: Morpho-physiological
assessment of; A. Plant height, B. Leaf area (fifth leaf from bottom), C. Stalk diameter, D. Fresh mass, E. Dry
mass, F. Seed weight of wild-type (Wt) and putative transgenic co-AlaAT tobacco lines (SAC1, SAC2
and SAC3) at N0, N75, N100, N125 kg/ha N fertilizer doses
Fig. 4: Biochemical evaluation of; A. Total free amino acids, B. Total nitrogen content, C. Crude proteins, D. AlaAT activity of wild-type (Wt) and putative transgenic co-AlaAT tobacco lines (SAC1, SAC2 and SAC3) at N0, N75, N100, N125 kg/ha N fertilizer doses
SAC2 and SAC5 varied significantly from each other and had
significantly higher crude proteins than SAC1 and wild-type at N0 fertilizer
dose. Similarly, SAC1, SAC2 and SAC5 possessed significantly more crude protein
than wild-type at N75, N100 and N125 fertilizer level (Fig. 4C). Alanine
aminotransferase activity of different transgenic lines was calculated at
various nitrogen fertilizer exposure levels. All the transgenic lines possessed
significantly higher alanine aminotransferase activity than wild-type control
at all fertilizer levels. However, highest AlaAT activity was measured in
SAC1, SAC2 and SAC5 lines at N75. Then its activity tends to be decreasing at N100
and N125fertilizer doses. Lowest level of alanine aminotransferase activity was
observed at N125 nitrogen regime in all transgenic and wild-type lines, even
then the level of AlaAT activity of all the
transgenic lines was significantly higher than wild-type plants at said
fertilizer dose (Fig. 4D).
Discussion
In an
effort to improve nitrogen use efficiency (NUE) in crop plants, a synthetic
codon optimized co-AlaAT gene was used in this
study. Codon optimized alanine
aminotransferase (co-AlaAT)
gene was introduced and overexpressed under 2XCaMV35S promoter in
tobacco (Nicotiana tabacum L.). Putative transgenic tobacco (T3)
lines having optimum expression of co-AlaAT was used for evaluation under different N fertilizer
regimes. The over-expression of co-AlaAT gene
and AlaAT
enzymatic activity resulted in significant increase in leaf area, stalk
diameter, fresh and dry masses, root dry weight and seed weight/plant as
compared to non-transformed wild-type control under various N fertilizer doses.
Pena et al. (2017) reported that
transformation of HvAlaAT
gene driven by constitutive and root specific promoter in wheat and sorghum,
exhibited higher alanine aminotransferase (Alt) activity. Increased Alt
activity influenced boosting of vegetative biomass, tillering
and plant height relative to wild type wheat plants under hydroponic
environment. However, wild type plants in case of tobacco, were using available
N for increasing their heights during rapid vegetative growth stage at
different N fertilizer applications. Nevertheless, putative transgenic tobacco
plants tend to accumulate and assimilate more N which was depicted in enhanced
leaf area, stalk diameter and biomass produce. These results corroborate when HvAlaAT gene was expressed under OsANT1
tissue-specific promoter in rice, wheat and sorghum (Shrawat
et al. 2008; Pena et al. 2017). A comparison of 2XCaMV35S:
co-AlaAT tobacco plants indicated that
over-expression of co-AlaAT gene showed
association with the increase in leaf area, stalk diameter, fresh/dry mass
produce (Fig. 3A-F) at N0, N75, N100 and N125 nitrogen fertilizer applications.
Contrary to higher expression values of inserted gene some time does not result
in the desired phenotype, in case of sorghum transformed with HvAlaAT,
displayed higher alt activity but no or little phenotypic changes were observed
(Pena et al. 2017). The differences
in values for these attributes in transgenic plants were prominent under low
level of nitrogen (N75) supply, whereas no or little differences were observed
under high nitrogen fertilizer applications (Shrawat et al. 2008; Snyman et al. 2015). It is indicated that under optimal and overdose of N
amendments (N100 and N125), the phenotypic and biochemical differences were
minimum (Good et al. 2007). Lines
SAC1, SAC2 and SAC5 exhibited highest amino acid, total N content, crude
proteins and AlaAT activity (Fig. 4A-D), which
represented direct association with the moderate to the highest expression of
co-AlaAT gene as investigated in sugarcane expressing
HvAlaA Tgene (Snyman et al. 2015). In these transgenic
tobacco lines synthetic co-AlaAT finally
resulted to improve nitrogen uptake, metabolism, assimilation, nutrient use
efficiency, phenotypic traits (McAllister and Good 2015; Snyman et al. 2015) and biochemical attributes
(Beatty et al. 2013; Pena et al. 2017). It has been demonstrated
that AlaAT activity is involved in the
production of either pyruvate or alanine for maintaining carbon-nitrogen
balance (Miyashita et al. 2007) and
control seed dormancy in the plant kingdom (Sato et al. 2016). Pena et al.
(2017) confirmed that vegetative biomass, grain yield, and nitrogen contents in
wheat were enhanced by
over-expression of HvAlaAT gene under
the control of root-specific and constitutive promoter. In this pot experiment,
transgenic tobacco plants sustained significantly higher biomass as compared to
wild-type control and resulted in 25-30% decrease in nitrogen fertilizer
requirement without causing any yield penalty as observed in case of HvAlaAT transgenic
sugarcane pot experiment (Snyman et al.
2015). The results of expressing synthetic co-AlaAT
in tobacco revealed many similar physiological, molecular and biochemical
attributes as observed in transgenic canola, rice, wheat and sorghum (Good et al. 2007; Shrawat
et al. 2008; Pena et al, 2017).
The increased fresh and dry biomass was evident from their high values
for leaf area, stalk diameter, fresh/dry biomass, seed weight (Fig. 3B-F), root
dry mass and less internodal distance (data not shown here) values. It is
implicated that reduced internodal distance in SAC2 and SAC5 as
compared to wild-type might be due to co-AlaAT
gene over-expression for speedy translocation of essential nutrients from root
to shoot. Root structure and size is an important parameter for ensuring
efficient nutrient supply to various parts of shoot system. Transgenic tobacco
plants retained densely arranged root system. SAC1, SAC2, and
SAC5 possessed bushier, more lateral root proliferation, finer roots and root
hairs as compared to wild-type (data not shown). Finer roots are reported to
have more surface area to volume ratio as compared to thick root and plants
nitrogen uptake is dependent on location, size and number of root hairs (Snyman
et al. 2015). It has been observed that
availability of nitrate may interfere with the location and number of lateral
root initiation sites (Malamy and Ryan 2001).
Transgenic tobacco revealed a significant increase in total free amino
acid, nitrogen content, crude protein, and alanine aminotransferase activity.
An increase in nitrogen flow was observed from Glutamine, Glutamate and Alanine
when barley AlaAT gene expressed under
the root-specific promoter in Brassica napus
(Good et al. 2007). These amino acids
are translocated to xylem sap immediately and trigger the plant growth. It is
true for transgenic tobacco transformed with the co-AlaAT
gene. Increase in alanine
aminotransferase activity significantly increases the amount of total free
amino acid, crude protein and total nitrogen content in transgenic lines (Pena et al. 2017). In shoot tissues an
increase in the level of certain amino acids like Glutamate, Glutamine and
Aspartic acid could be utilized as available nitrogen pool for the creation of
nitrogen-containing compounds or other amino acids (Shrawat
et al. 2008). Glutamine (Gln) is proposed to play a central role as a possible
signaling molecule and in amino acid metabolism. Synthetic co-AlaAT gene could play a vital role in starch
synthesis under hypoxic or limited N condition (Yang et al. 2015).
SAC1, SAC2 and SAC5 lines confirmed significant improvement in N
efficient phenotype when compared with wild-type control. Prominent N efficient
phenotype was observed in transgenic lines SAC1 and SAC2 under limited N (N0
and N75) supply, indicating their efficiency to uptake available N while SAC2
and SAC5 were performing better at higher N doses (N100 and N125) indicated
their responsiveness to optimal or overdoses. These results are promising and
support the application of transgenic approaches for improvement of nitrogen
use efficiency in crop plants which could reduce the fertilizers input cost,
increase the profitability in term of yield and decrease the environmental
damage or probable risk to human health due to nitrates toxicity (Ahmed et al. 2017).
Optimal and efficient use of N fertilizer by plants is important to
increase crop yield, to reduce fertilizers application and their hazardous
impact on environment. The over-expression of co-AlaAT
gene enhances the N uptake, translocation and mobilization. It is therefore
assumed that synthetic co-AlaAT gene could be transformed in major crop plants to
enhance their N efficient phenotype. However, N efficient phenotype is a
complex and multifactorial trait might be influenced by genetic, environmental
and climatic change. Therefore, vigilant precautions should be considered upon
evaluation of selected lines. As enhanced AlaAT
activity exhibited N
efficient phenotypes in transgenic wheat lines but Alt activity did not
translate to significant phenotypic effects in sorghum when transformed with HvAlaAT gene (Pena et al. 2017). Therefore, it is assumed that synthetic biology tools
could help to achieve desired results in required crop plants.
Conclusion
Alanine aminotransferase (AlaAT) is an
important metabolic pathway gene for nitrogen acquisition, translocation and
metabolization in plants. Over-expression of synthetic codon optimized alanine aminotransferase gene under
double strength of constitutive (2xCaMV35S)
promoter in tobacco resulted in various morphological, physiological and
biochemical changes in stably transformed plants. It has been envisaged that
synthetic alanine aminotransferase
gene could be used to achieve improvement of crop productivity and yield enhancement under limited N
fertilizer application.
References
Ahmed M, M Rauf, Z Mukhtar, NA Saeed (2017). Excessive use of
nitrogenous fertilizers: an unawareness causing serious threats to environment
and human health. Environ Sci Pollut
Res 24:26983‒26987
Araus V, EA Vidal, T Puelma, S Alamos, D Mieulet, E Guiderdoni, RA Gutierrez (2016). Members of BTB family of
scaffold proteins suppress nitrate uptake and nitrogen use efficiency. Plant Physiol
171:1523‒1532
Beatty PH, RT Carrol, AK Shrawat, D Guevara, AG
Good (2013). Physiological analysis of nitrogen efficient rice overexpressing
alanine aminotransferase under different N regimes. Botany 91:866‒883
Bremner JM (1965). Total Nitrogen.
Methods of soil analysis Part 2. In:
Chemical and Microbial Properties, pp: 1049‒117. Black CA (eds.). Number 9
in series Agronomy. American Society of Agronomy, Inc. Publisher, Madison, Wisconsin,
USA
Chen J, X Fan, K
Qian, Y Zhang, M Song, Y Liu, G Xu, X Fan (2017). pOsNAR2.1: OsNAR2.1
expression enhances nitrogen uptake efficiency and grain yield in transgenic
rice plants. Plant Biotechnol
J 15:1273‒1283
Doyle JJ, JL Doyle (1987). A rapid DNA isolation
procedure for small quantities of fresh leaf tissue. Phytochem Bull 19:11‒15
Garnett T, D Plett, S Heuer,
M Okamoto (2015). Genetic approaches to enhance nitrogen use efficiency (NUE)
in cereals: challenges and future directions. Funct
Plant Biol 42:921‒941
Good AG, SJ
Johnson, SD Pauw, RT Carrol,
N Savidov, J Vidmar, Z Lu,
G Taylor, V Stroeher (2007). Engineering nitrogen use
efficiency with alanine aminotransferase. Can J Bot 85:252‒262
Good AG, AK Shrawat, DG Muench (2004). Can
less yield more? Is reducing nutrient input into the environment compatible
with maintaining crop production? Trends Plant Sci 9:597‒605
Hamilton PB, DDV Slyke (1943). The gasometric
determination of free amino acids in blood filtrates by the ninhydrin-carbon
dioxide method. J Biol Chem 150:231‒250
Kraiser T, DE Gras, AG Gutie´rrez, B Gonza´lez, RA Gutie´rrez (2011). A holistic view of nitrogen acquisition
in plants. J Exp Bot 62:1455‒1466
Krapp A, IC David, C Chardin, TM Girin, A armagne, AS Leprince, S Chaillou, S Ferrario-Mery, F
Daniel-Vedele (2014). Nitrate transport and signaling
in Arabidopsis. J Exp Bot 65:789‒798
Malamy JE, KS Ryan (2001).
Environmental regulation of lateral root initiation in Arabidopsis. Plant Physiol 127:899‒909
McAllister CH, AG
Good (2015). Alanine aminotransferase variants conferring diverse NUE
phenotypes in Arabidopsis thaliana. PLoS One, 10; Article e0121830
McAllister CH,
PH Beatty, AG Good (2012). Engineering nitrogen use
efficient crop plants: the current status. Plant
Biotechnol J 10:1011‒1025
Miyashita Y, R Dolferus, P Ismond, AG Good (2007).
Alanine aminotransferase catalyses the breakdown
alanine after hypoxia in Arabidopsis thaliana. Plant J 49:1108‒1121
Mu X, F Chen, Q Wu, Q Chen, J Wang, I Yuan, G Mi (2015). Genetic improvement
of root growth increases maize yield via
enhanced post silking nitrogen uptake. Eur J Agron 63:55‒61
Murashig T, F Skoog (1962). A revised medium for rapid growth and bio
assays with tobacco tissue cultures. Plant
Physiol 15:473‒499
Pena PA, T Quach, S
Sato, Z Ge, N Nersesian, IM
Dweikat, M Soundararajan, TE
Clement (2017). Molecular and phenotypic characterization of transgenic wheat
and sorghum events expressing the barley alanine aminotransferase. Planta 246:1097‒1107
Santiago JP, M Tegede (2016). Connecting source with sink: the role of
Arabidopsis AAP8 in phloem loading of amino acids. Plant Physiol 171:508‒521
Sato K, M Yamane, N
Yamaji, H Kanamori, A Tagiri, GJ Schwerdt, BG Fincher,
T Matsumoto, K Takeda, T Komatsuda (2016). Alanine
aminotransferase controls seed dormancy in barley. Nat Commun 10; Article 11625
Shrawat AK, RT Carrol, MD Pauw, J Gregory, G
Taylor, AG Good (2008). Genetic engineering of improved nitrogen use efficiency
in rice by the tissue specific expression of alanine aminotransferase. Plant Biotechnol J
6:722‒732
Snyman SJ, E Hajari,
MP Watt, Y Lu, JC Kridl (2015). Improved nitrogen use
efficiency in transgenic sugarcane: Phenotypic assessment in a pot trial under
low nitrogen conditions. Plant Cell Rep
34:667‒669
Tegeder M (2014).
Transporters involved in source to sink partitioning of amino acids and
ureides: opportunities for crop improvement. J Exp Bot 65:1865‒1878
Yang J, SR Kim, SK
Lee, H Choi, JS Jeon (2015). Alanine aminotransferase1 (OsAlaAT1) plays
an essential role in the regulation of starch storage in rice endosperm. Plant Sci 240:79‒89
Zhang I, MG
Garneau, R Majumdar, J Grant, M Tegeder (2015).
Improvement of pea biomass and seed productivity by simultaneous increase of
phloem and embryo loading with amino acids. Plant
J 81:134‒146
Zhu S, JM Vivanco, DK Manter (2016).
Nitrogen fertilizer rate affects root exudation, the rhizosphere microbiome and
nitrogen use efficiency of maize. Appl Soil Ecol 107:324‒333